Contributions of the loops on the stability and targeting of DNA pseudoknots

Introduction

The formation of nucleic acids secondary structures, such as hairpin loops, triplexes, G-quadruplexes, pseudoknots, and i-motifs is well documented [1-4] and they have been postulated to be involved in a variety of biological functions [4-14]. Pseudoknots belong to an interesting and diverse RNA structural motif, due to variation in their loop lengths and stems and the types of interactions between them. Pseudoknots have diverse roles in biological function; examples include forming the catalytic core of various ribozymes [15-17], self-splicing introns [18], telomerase [19,20], riboswitches [21], and ribosomal frameshifting [22,23]. In ribosomal frameshifting a pseudoknot and slippery sequence are involved to change the reading frame allowing for different mRNAs to be translated which is a very common mechanism found in viruses [22]. It has been shown that a local formation of base-triplet stacks within the pseudoknot increases the stability of the terminal stem and the interaction of this triplex structure with the ribosome might help with the high-efficiency of frameshifting [23]. The targeting of pseudoknots with nucleic acid oligonucleotides (ODNs) may stop their biological regulation [24-29].

ODNs, as drugs, present an exquisite selectivity and are able to discriminate targets that differ by a single base and can be used to control the expression of genes. [5-7,24]. There are three main approaches for the use of ODNs as modulators of gene expression: the antisense, antigene, and small interfering RNA strategies [24]. In the antisense strategy, an ODN binds to messenger RNA, forming a DNA/RNA hybrid duplex that inhibits translation by blocking the assembly of the translation machinery or by inducing an RNase H mediated cleavage of their mRNA target [5]. In the antigene strategy, an ODN binds to the major groove of a DNA duplex, forming a triple helix [30] that inhibits transcription, by competing with the binding of proteins that activate the transcriptional machinery [7,31]. There are advantages and disadvantages in these two strategies. In the direct targeting of a gene, the antigene strategy offers some advantages over the antisense strategy. First of all, there are only two copies of a particular gene whereas there is a large continuous supply of the mRNA gene transcript. Moreover, blocking the transcription of the gene itself prevents repopulation of the mRNA pool, allowing a more efficient and lasting inhibition of gene expression [32,33]. The main disadvantage is that the ODN needs to cross the nuclear membrane and access its DNA target within the densely packed chromatin structure [34]. Common disadvantages of the use of ODNs for targeting purposes are that the oligonucleotide needs to cross lipid membranes; for instance, hydrophilic ODN duplexes do not cross lipid membranes [35], and the fast degradative action of nucleases. These disadvantages can be circumvented by using single strands and by chemically modification of its phosphate or sugar groups. The presence of unpaired nucleobases renders the ODN more hydrophobic, allowing them to interact better with polycationic micelles and/or enabling them to cross the cellular membranes. These polycations can be used as delivery vectors, protecting the ODN from the action of nucleases.

From a thermodynamic point of view, successful control of gene expression depends on the effective binding of a DNA oligonucleotide sequence to its target with tight affinity and specificity. This is provided by using a long sequence of 15-20 bases in length when targeting genes [5]; strong specificity is conferred by hydrogen bonding in the formation of Watson-Crick and/or Hoogsteen base-pairs, while high affinity is provided by the large negative free energy upon formation of a duplex or triplex products; thereby, competing efficiently with the proteins involved in transcription or translation. In the successful targeting of nucleic acid secondary structures with complementary strands, the strand must be able to invade and disrupt the secondary structure forming a large number of base-pair stacks in the duplex products. Our laboratory is using DNA oligonucleotides to mimic the secondary structures of RNA molecules and their targeting with complementary strands to create a library of thermodynamic targeting data [27-29]. The novelty of this approach is several fold, DNA oligonucleotides are less expensive than RNA oligonucleotides and more stable against hydrolysis, and most important the resulting DNA-DNA thermodynamic data is similar to the DNARNA thermodynamic data [36-38], which is obtained in the targeting of RNA molecules with DNA complementary strands.

In this work, we have designed a pair of DNA pseudoknots with different length in one of the loops to mimic the formation of a local triple helix shown within RNA pseudoknots of the human telomerase, explaining the increase efficiency of ribosomal frameshift. To this end, we have used a combination of UV spectroscopy and calorimetric techniques to determine the thermodynamics for both the unfolding of both DNA pseudoknots and their targeting with complementary strands. The results show that the pseudoknot with the longer loop is more stable and forming a local triplex structure, consistent of two base-triplet stacks, which is confirmed with the lower free energy obtained in the targeting of this pseudoknot.

Methods

The 5'-3' sequences of oligonucleotides (ODNs) are as follows: d(TCTCTT₅ AAAAAAAAGAGAT₅ TTTTTTT) and d(TCTCTT₉ AAAAAAAAGAGAT₅ TTTTTTT), T₅  and T₉  are loops of 5 and 9 thymines, respectively; and complementary strands, d(CTTTTTTTTAAAAAAGAGA) and d(CTTTTTTTTAAAAAAAAAAGAGA). ODNs were synthesized by Integrated DNA Technologies, Inc. (Coralville IA), purified by reverse-phase HPLC, and desalted by gel permeation chromatography using a G-10 Sephadex column. Figure 1 shows the putative secondary structures and designations of pseudoknots, complementary strands and resulting duplexes. The ODN concentrations were determined at 260 nm and 90°C using the following molar extinction coefficients (mM^-1cm^-1), obtained from the nearest-neighbor model [39]: 331.1 (PsK-5 ), 180.6 (CS-5 ), 255.9 (PsKDup-5 ), 366.6 (PsK-9 ), 236.9 (CS-9 ) and 301.8 (PsKDup-9 ). All experiments were carried out in 10 mM sodium phosphate 100 mM NaCl buffer at pH 7.0. All oligonucleotide solutions were prepared by dissolving dry and desalted ODNs in buffer, and then heating the solution to 70°C then cooled to the starting experiment temperature.

Temperature-dependent UV spectroscopy
Absorbance versus temperature profiles were measured at 260 nm with a thermoelectrically controlled Aviv Spectrophotometer Model 14DS UV-Vis (Lakewood, NJ). The temperature was scanned at a heating rate of 0.6°C/min, and shape analysis of the melting curves yielded transition temperatures, T_Ms [40]. The transition molecularity for the unfolding of a particular complex was obtained by monitoring T_M as a function of the strand concentration. Intramolecular complexes show a T_M-independence on strand concentration, while the T_M of intermolecular complexes does depend on strand concentration [41].

Differential scanning calorimetry (DSC)
The total heat required for the unfolding of each oligonucleotide (pseudoknot, single strand or duplex product) was measured with a VP-DSC differential scanning calorimeter from Microcal (Northampton, MA). Standard thermodynamic profiles and T_Ms are obtained from the DSC experiments using the following relationships [40,41]: ΔH=∫ΔCp(T)dT; ΔS=∫ΔCp(T )/TdT, and the Gibbs equation, ΔG°_(T)=ΔH - TΔS; where ΔCp is the anomalous heat capacity of the ODN solution during the unfolding process, ΔH and ΔS are the unfolding enthalpy and entropy, respectively, assumed to be temperature-independent. ΔG°_(T) is the free energy at a temperature T.

Isothermal titration calorimetry (ITC)
The heat for the reaction of a pseudoknot with its complementary strand was measured directly by isothermal titration calorimetry using the ITC₂₀₀ from GE Microcal (Northampton, MA). A 40 μL syringe was used to inject the titrant; mixing was effected by stirring this syringe at 1000 rpm. Typically, we used 5-7 injections of 2 μL of pseudoknot solution with at least 2-fold lower concentration than the solution of the complementary strand in the cell, and over a time of 4-8 minutes between injections. The reaction heat of each injection is measured by integration of the area of the injection curve, corrected for the dilution heat of the titrant, and normalized by the moles of titrant added to yield the reaction enthalpy, ΔH_ITC [27-29,42]. All titrations ITC experiments were designed to obtain the heat, ΔH_ITC, for each targeting reaction by averaging the reaction heat of at least five injections under unsaturated conditions. These ΔH_ITC terms correspond to the formation of duplex products. To determine the free energy, ΔG_ITC, for each targeting reaction, we use the following relationship, ΔG_ITC=ΔG_HC (ΔH_ITC/ΔH_HC) [27-29], while the Gibbs equation is used to determine the TΔS_ITC parameter, where T is the temperature of the ITC experiments.

Overall experimental protocol
We used initially UV melting techniques to characterize the helix-coil transition of each molecule as a function of strand concentration. DSC experiments are carried out to determine T_Ms and unfolding thermodynamic profiles for each pseudoknot and for the other reactants and products of each targeting reaction [40,43]. The DSC data is used to set up Hess cycles to yield thermodynamic profiles for these reactions. Then, ITC titrations are used to measure directly the heat (ΔH_ITC) of each targeting reaction, which are compared with the Hess cycle data [27-29].

Results and discussion

Unfolding thermodynamics of pseudoknots
Figure 2a shows typical UV melting curves for the helix-coil transition of each pseudoknot, their sigmoidal behavior is characteristic of the temperature-induced unfolding of a nucleic acid oligonucleotide. The T_M dependences on strand concentration are shown in Figure 2b, the T_M remains constant for each pseudoknot, indicative of their intramolecular formation at low temperatures. The DSC curves of each pseudoknot are shown in Figure 2c and the resulting thermodynamic profiles are shown in Table 1. Each curve shows slightly asymmetric peak, which is not consistent with the unfolding of an intramolecular complex. This observation may be explained in terms of loop constraints on the pseudoknot stems, which reduces favorable stacking contributions. The overall effect is most noticeable with PsK-5 , which actually shows a small shoulder at around 37°C. We obtained unfolding enthalpies of 60.1 kcal/mol (PsK- 5 ) and 87.5 kcal/mol (PsK-9 ), while an unfolding enthalpy of 69.4 kcal.mol (data not shown) was obtained for a duplex (^5'-TCTCTTTTTTTT/^5'-TTAAAAAAAAGAGATT) with sequence similar to their stem and with two thymines flanking each end.

This enthalpy comparison shows that the loops of PsK-5  are constrained while the longer loop of PsK-9  is actually releasing this tension. However, the main observation is PsK-9  unfolds with a higher T_M, by 6.5°C, and higher unfolding enthalpy, by 27.4 kcal/mol (Table 1). This indicates that PsK-9  is more stable with improved base-pair stacks. Alternatively, the observed additional heat suggests that the 9 thymine loop of PsK-9  is located in the ceiling of the major groove of its 7 A•T stem, and three thymines (starred thymines of Figure 1) are involved in the formation of three T*A•T base-triplets (or two T*AT/T*AT base-triplet stacks) [44,45]. Overall, the unfolding of each pseudoknot takes place through the typical unfavorable enthalpy-favorable entropy compensation. Unfavorable enthalpy contributions correspond to energy needed to break base pairing and base-pair stacking interactions, while favorable entropy contributions correspond to the higher disorder state of the single strand at high temperature and the putative release of ions and water molecules [27-29,46]. In summary, the folding of PsK-9  is thermodynamically more stable than PsK-5 (reverse signs of Table 1), by -5.7 kcal/mol, resulting in a more compact molecule.

Targeting of pseudoknots with complementary strands
To confirm PsK-9  is forming a more compact pseudoknot, we investigated the reaction of each pseudoknot with its corresponding complementary strand to form duplex products with dangling ends:

1. PsK-5 + CS-5 ⇌ PsKDup-5 ; and
2. PsK-9 + CS-9 ⇌ PsKDup-9

Each reaction was investigated in two ways: a) indirectly by determining unfolding thermodynamic profiles for the reactants and products of each targeting reaction, and b) directly using ITC techniques.

Unfolding thermodynamics for the species of each targeting reaction
Figure 3 shows the DSC thermograms of each pseudoknot, complementary strand, and duplex product, and Table 1 has the resulting thermodynamic profiles from the analysis of these thermograms. The DSC of each pseudoknot was discussed earlier; their unfolding curves are included in this figure for clarity and for explaining the unfolding of each product duplex. The DSC of each single strand shows monophasic transitions with T_Ms and ΔHs of 47.9°C, 38.4 kcal/mol (CS-5 ) and 48.6°C, 48.5 kcal/mol (CS-9 ), respectively. UV melting experiments as a function of strand concentration (data not shown) show their T_Ms remain constant, indicating their intramolecular formation. Based on their sequence, magnitude of their enthalpies, and assuming an enthalpy of 7-8 kcal per mol of base-pair stack, these single strands are forming hairpin loops with dangling ends and with 5 (CS-5 ) and 6 (CS-9 ) base-pair stacks in their stems.

UV melting experiments of the duplex products, as a function of strand concentration, show that the T_Ms increased slightly (data not shown), indicative of their bimolecular formation. These T_M-dependences are consistent with the unfolding of duplexes with 19 and 23 base pairs, which are approaching the unfolding behavior of polymers. The DSC curves of each product duplex (Figure 3) show PsKDup-5  unfolds in an apparent monophasic transition with a T_M of 49.6°C and ΔH of 135 kcal/mol, while PsKDup-9  unfolds in a biphasic transition with T_Ms of 47.7°C and 58.3°C and total ΔH of 161 kcal/mol. Each DSC profile corresponds to the unfolding of the duplex followed by the folding and sequential unfolding of the corresponding pseudoknot and hairpin (single strands). For instance, the monophasic unfolding of PsKDup-5  is due to the similar T_Ms of the structures formed by the reactants and product of this reaction, which are within 5°C. On the other hand, PsKDup-9  shows a biphasic transition (Figure 3b), the first transition corresponds to the unfolding of the duplex into partial folded of both PsK-9  and CS-9 , followed by the simultaneous unfolding of CS-9  and pseudoknot. The higher ΔH term of PsKDup-9 , by 26 kcal/mol, corresponds to the formation of two additional base-pair stacks.

We created Hess cycles with this unfolding data to generate indirectly thermodynamic profiles for each targeting reaction i.e., we added the thermodynamic profiles of the pseudoknot and single strand (hairpin), and subtracted the thermodynamic profiles of the duplex. The resulting data is shown in the last two entries of Table 1. This exercise yielded ΔG°_HC and ΔH_HC of -5.1 kcal/mol & -37 kcal/mol (PsK-5 ), and -3.5 kcal/mol & -25 kcal/mol (PsK-9 ), respectively. Both reactions are favorable and enthalpy driven. However, the targeting of PsK-9  is less favorable, which is consistent with the higher stability of this pseudoknot. Furthermore, we obtained unfavorable TΔS_HC terms of -31.4 (PsK-5 ), and –21.7 kcal/mol (PsK-9 ), which correspond to the net uptake of ions and water molecules by the duplex products of each reaction, since the conformational entropy change is considered similar for each reaction.

Targeting reactions measured directly by ITC techniques The heat for each targeting reaction was measured by ITC under unsaturated conditions, using ODN concentrations and temperatures that guaranteed 100% formation of the final duplex products. ITC titrations were carried out at 5°C, the heat of each injection was corrected for its dilution heat and normalized by the concentration of the limiting reagent to yield reaction enthalpies, ΔH_ITC. The ITC titrations are shown in Figure 4a (PsK-5 ) and Figure 4b (PsK-9 ), the shape of these curves show that the initial enthalpies are more exothermic, -32.0 kcal/mol and -33 kcal/mol, and gradually reaching a plateau at -27.3.0 kcal/mol and -21.2 kcal/mol, respectively. The net exothermicity of these enthalpy values corresponds to a complete override of the endothermic heat contributions (disruption of the base-pair stacks of both pseudoknot and hairpin loop) by the exothermic heat contributions (formation of base-pair stacks of the duplex product). An extra exothermic/endothermic term should be included due to hydration changes from the participating reaction species, which may be accounted for the variability of the reaction enthalpies in these titrations. The average heat for all injections of a particular titration are ΔH_ITCs of -28.2±1.4 kcal/mol (PsK-5 ) and -23.7±1.2 kcal/mol (PsK-9 ), which are in good agreement with the ΔH_HC values of -36.5±3.7 kcal/mol and -25.0±2.5 kcal/mol, respectively, obtained indirectly by the Hess cycles from the DSC data.

The ΔG°_ITC at 5°C for each targeting reaction were obtained from the ΔG°_HC values by using a temperature factor (=ΔH_ITC/ ΔH_HC), which assumes ΔH_HCs to be independent of temperature i.e., ΔCp=0. The TΔS_ITC parameters were calculated using the Gibbs equation. The overall results are shown in Table 1. We obtained favorable ΔG°_ITC contributions for each targeting reaction, each complementary strand is able to invade and disrupt the pseudoknot structure. However, the reaction for the targeting of PsK-9  is less favorable in spite of forming a more stable duplex, by 0.7 kcal/mol. This result is consistent with the higher stability PsK-9  and confirms the formation of a local triplex in the stem of PsK-9  consistent of three T*A•T base-triplets (or two T*AT/T*AT base-triplet stacks).

Conclusions

We have investigated the thermodynamic stability of two pseudoknots to determine the formation of a local and short triplex in the pseudoknot with a longer thymine loop. Specifically, we used a combination of UV, DSC, and ITC techniques to determine the unfolding thermodynamics of a pair of pseudoknots and their reaction with complementary strands. The favorable folding of DNA pseudoknots results from the typical favorable enthalpy-unfavorable entropy compensation, confirming the flexibility of DNA strands being able to form pseudoknots that can be used to mimic known RNA secondary structures. The folding data shows that PsK-9  is more stable due to a more favorable enthalpy. This enthalpy value corresponds to the partial folding of the thymine loop (third strand) on the major groove of the duplex, yielding a net formation of two T*AT/T*AT base-triplet stack sat the middle of its stem. The targeting thermodynamic data indicated that each complementary strand is able to disrupt the pseudoknots. However, the disruption of PsK-9  takes place with a less favorable free energy contribution, confirming the formation of a short and local triplex.

The main observation from this study is that a triplex is able to form in the pseudoknot if the loop length and sequence are appropriate. The favorable targeting of these pseudoknots depends on the length and sequence of the complementary strand. However, the favorable free energy term of these targeting reactions may well be increased by improving the stability of the duplex products, by using longer single strands with complementary sequences and/or DNA intramolecular structures with loops containing a larger number of un-paired bases. In general, the higher the number of base-pairs and base-pair stacks that are formed in the duplex product, the higher the free energy term; specifically, if a larger number of unpaired bases are involved in this base-pairing. This investigation of the targeting of DNA pseudoknots has enabled us to improve our method, based on physicochemical principles, to determine the thermodynamics of the targeting of nucleic acid secondary structures that can be used to control the expression of genes.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

Acknowledgement

This work was supported by National Science Foundation Grant MCB-1122029 and GAANN grant P200A120231 (C.R.) from the U.S. Department of Education.

Publication history

Editor: Leonid Breydo, University of South Florida, USA.
EIC: John Wade, University of Melbourne, Australia.
Received: 17-Jun-2014 Final Revised: 01-Aug-2014
Accepted: 07-Aug-2014 Published: 28-Aug-2014