Table I : Primers used.


Primer Sequence (5`--- 3`) Uses

NRfor GCGCTGCCCTCCGTCACCTTCC Estimation of the number of NR genes by qPCR
NRre CAGCCGCACGCCCGTCCAGTAG
Parafor GAGGATCTGGACGAGGAGCGGAA Estimation of the number of AphVIII genes by qPCR genes
Pararev CCCTCAGAAGAACTCGTCCAACAGC
RB1 AGCTGGCCCACGAGGAGGAC Identification of the region adjacent to the marker gene by iPCR (3' end)
LB1 CCAGAGCTGCCACCTTGACA
RB4 TGGTTCGGGCCGGAGTGTTC
LB3 CCACCACCCCGAAGCCGATAA
Rbsc0 CCCTCCCCGGTGCTGAAGAAT Identification of the region adjacent to the marker gene by iPCR (5' end)
LRbsc3 GTCGCGTATGTATAAGTGCTCGTTTG
Rbsc2 CCGGTTGTGAGTGGGTTGTTGT
LRbsc2 CGTTCGGGGTCGCGGGCTTTTA
RB1 AGCTGGCCCACGAGGAGGAC Identification of the region adjacent to the marker gene by RESDA
Deg Alu CCAGTGAGCAGAGTGACGIIIIINNSWCAGCTT
Deg PstI CCAGTGAGCAGAGTGACGIIIIINNSWCAGCTT
Deg SacII CCAGTGAGCAGAGTGACGIIIIINNSCTGCAGW
Deg TaqI CCAGTGAGCAGAGTGACGIIIIINNSCCGCGGW
RB4 TGGTTCGGGCCGGAGTGTTC
Q0 CCAGTGAGCAGAGTGACG

León et al.Genomics Discovery  2013 1:2DOI : 10.7243/2052-7993-1-2