Table 1. Primers used for strand-specific RT-PCR in this study.


Transcript
to be detected
Sequence (5’–>3’) RT/
PCR1
Direction cDNA
(bp)2

CCL2 mRNA GGCATCACATTCCAAATCACA
GCTGTCTCAGCCAGATGCAGTTA
GATCTCACTTGGTTCTGGTCCAG
RT
PCR
PCR
Reverse
Forward
Reverse
228
CCL2 asRNA ACCAGTATGACAGAGAACTAG
TGTGATTTGGAATGTGATGCCTTA
CAATACCTTGGACTCTCAAACAC
RT
PCR
PCR
Forward
Forward
Reverse
201
CCL20 mRNA CATCCCAGAAAAGCATCCGTT
CAGCCAGTCAGAAGCAGCAAGCA
CTTGGTTCTTAGGCTGAGGAGGT
RT
PCR
PCR
Reverse
Forward
Reverse
223
CCL20 asRNA CAGTGGTCTTGTCCAATGGAT
ATTCATATTGCATCATAGTGTGTC
ATTTAAGAAACAATTAAGCACACAG
RT
PCR
PCR
Forward
Forward
Reverse
248
CD69 mRNA GTCACCTATACCTCTATGCTT
TTGCCTTAAGTGTGGGCAAGTAC
CCTGTCACGTTGAACCAGCTGTT
RT
PCR
PCR
Reverse
Forward
Reverse
331
CD69 asRNA TGACTGGATGCTACTCTGTGA
ACTCTTCCAGATAGATAGGACTA
ATGCATGAAGGCGCTGGCTTTTG
RT
PCR
PCR
Forward
Forward
Reverse
231
CX3CL1 mRNA ACCAGGACGTACGAGTTACTG
GTACTCTGCTGGCGGGTCAGCAC
TCTCGTCTCCAGGATGATGGCGC

RT
PCR
PCR

Reverse
Forward
Forward
149
CX3CL1 asRNA TTGGGAAGCTTGTGGGAGGCT
TGGCTCCAGAGTACTAGTTGTAG
TGGCACAGACATTGGTAATGATG
RT
PCR
PCR
Forward
Forward
Reverse
200
EF mRNA TCTGGTTGGAATGGTGACAACATGC
CCAGGAAGAGCTTCACTCAAAGCTT
PCR
PCR
Forward
Reverse
335
IkB-a mRNA GAGGACGGAGACTCGTTCCTGC
AAGTGGAGTGGAGTCTGCTGCA
PCR
PCR
Forward
Reverse
137
IkB-a asRNA TCCAGAATCTGATAAAAGGACCAC
TGAACCGCCATAGACTGTAGCTG
GAAAGTGGTACAAATCTCAGCTGG
RT
PCR
PCR
Forward
Forward
Reverse
107
IL-23A mRNA CATGGGAACCTGGGCATCCTT
CAAGGACAACAGCCAGTTCTGTT
GGTGATCCTCTGGCTGGAGGAGC
RT
PCR
PCR
Reverse
Forward
Forward
176
IL-23A asRNA AGTGAGCCTAGGCTTTGGCCA
GAAATGTGAAGACTCACAGTGCT
CAATCCTCTAAACTGTTACAAGGA
RT
PCR
PCR
Forward
Forward
Reverse
205
NF-kB p65
mRNA
ACCCCTTTCAAGTTCCCATAGA
ACCTCAATGTCTTCTTTCTGCAC
PCR
PCR
Forward
Reverse
262
NF-kB p65
asRNA
CAGCTTCTAGCACTCTCCTAG
TATCCAGTGTCTTCCTCGACATG
TGCCCTGCTATTAAGGCACTTGA
RT
PCR
PCR
Forward
Forward
Reverse
265
NF-kB p50
mRNA
CCTGCTCCTGGAGGGTGACGCC
GTATGTCAAATACCTGCCAGTTG
PCR
PCR
Forward
Reverse
254
NF-kB p50
asRNA
CTGTCATTAAGGTATCGCAGTCC
CATCTACAGTACAGTCATGCACTC
GGGAAAATACTATTTTCAGCACTGAT
RT
PCR
PCR
Forward
Forward
Reverse
192

1. Gene-specific sense primers used for reverse transcription (RT) to synthesize complementary DNA (cDNA) to the antisense transcript (as- RNA). A gene-specific antisense primer or an oligo(dT) primer used to synthesize cDNAs for each mRNA. Primer pairs used for polymerase chain reaction (PCR).

2. The size of the cDNA fragment amplified by each pair of PCR primers is shown in base pairs (bp). CCL, chemokine C-C motif ligand; CX3CL1, chemokine C-X3-C motif ligand 1; EF, elongation factor 1α; IκB-α, inhibitor of nuclear factor κB α; IL-23A, interleukin 23, α subunit; and NF-κB, nuclear factor κB.

Nishizawa et al.  2012 1:10DOI : 10.7243/2050-0874-1-10