Table 1: Name of candidate genes along with their primer sequence and amplicon size and SSR marker information for Pop-DG


S No.

Primer
Name

Forward (5’-3’)

Reverse (5’-3’)

Temp (°C)

Amplicon
Size (bp)

Polymorphism type


1

CG1

GCTGATTACATGTAAGTACTCAAGG

GTAGCCTCACTGCAAAGGTAT

57

291

SSR

2

CG2

AACCTCTCCAGAATACCACTC

TATTTCAAGAGCTGAGTTTGG

57

218

SSR

3

CG5

TAGAGACAGCAAACAGAGGAA

AAACCCATCTTCTGCTTCTAC

57

129

SSR

4

CG6

TTCTGGTACCGAACGAAA

AGCACTAATCAGCTCCTAA

57

138

SSR

5

CG7

GGCGCTTCCTCCTTATACAAC

GATCTGGCCGAGACTGAATG

57

201

SSR

6

CG12

ATGAAGAGTTTGTGGCAAGG

CCACTTCATTCACAATCACG

57

211

SSR

7

CG14

GAGGTGTTGGAACCATCAAG

GGTAGTTGCTGGTGCTCTTT

57

219

SSR

8

CG16

CGGTCAATCTTCCGATATTC

TTCCTCGCTCATATTGGACT

57

205

SSR

9

CG18

AGTCCCTGGATTCCTCAAA

ACACACGAGTGACCAGCA

57

257

SSR

10

CG19

CGTGAAGAAGCCTCACAGA

TCCTCAAACAACCCAACAA

57

216

SSR

11

CG30

ATTGCAACGGAAACCAACT

AATGCGTGGATCGTTCTTT

57

248

SSR

12

CG31

AAGGGTCATGTGACCTGCT

AGTCGAAGCCATTAATGCAG

57

248

SSR

13

CG36

CTAAGAGACCCGAGGTTGAAG

AGCTTCATGTCTGTCAAGTGG

57

242

SSR

14

CG37

GACAGCAAAAACGAAGGTTG

TACGGCTCTTGTTCTTGTCC

57

288

SSR

15

CG38

AGTTCTTCAGATGCCAACCAT

TTGTCCCTGTCTTCATCCAT

57

299

SSR

16

CG40

GAAGCCTGCCATTGATTCTA

ATCTCGCGTAATGTCTCCAC

57

248

SSR


 

SSRs

Forward (5’-3’)

Reverse (5’-3’)

Temp (°C)

Amplicon
Size (bp)

Polymorphism type


1

BPPCT-021

TGCATGAGAAACTTGTGGC

CCAAGAGCCTGACAAAGC

57

288

SSR

2

BPPCT-020

CGTGGATGGTCAAGATGC

ATTGACGTGGACTTACAGGTG

57

216

SSR

3

BPPCT-021B

TGCATGAGAAACTTGTGGC

CCAAGAGCCTGACAAAGC

57

248

SSR

4

UCDCH15

TGCATGAGAAACTTGTGGC

CCAAGAGCCTGACAAAGC

57

248

SSR

5

BPPCT-036

AAGCAAAGTCCATAAAAACGC

GGACGAAGACGCTCCATT

57

248

SSR

6

BPPCT-015

ATGGAAGGGAAGAGAAATCG

GTCATCTCAGTCAACTTTTCCG

57

129

SSR

7

BPPCT-026

ATACCTTTGCCACTTGCG

TGAGTTGGAAGAAAACGTAACA

57

138

SSR

8

BPPCT-017

TTAAGAGTTTGTGATGGGAACC

AAGCATAATTTAGCATAACCAAGC

57

218

SSR


Dhanapal et al.Journal of Plant Science and Molecular Breeding  2012 1:3DOI : 10.7243/2050-2389-1-3