Table 2. Primers used for FOV race identification.


Primer name

Forward 5' to 3'

Reverse 5' to 3'

Amplicon size, bp


Ribosomal DNA (rDNA) (1)

 


18S

TTTCCGTAGGTGAACCTGCGGAAGG

-

600

28S

-

CGCTTATTGATATGCTTAAACTCA


Translation elongation factor (EF-1α), (27)

 


EF-1

ATGGGTAAGGAAGACAAGAC

-

600

EF-2

-

GGAAGTACCAGTGATCATGTT


β-tubulin (BT), (18)

 


BT-3

CGTCTAGAGGTACCCATACCGGCA

-

500

BT-5

-

GCTCTAGACTGCTTTCTGGCAGACC


Abdurakhmonov et al.Journal of Plant Science and Molecular Breeding  2013 2:3DOI : 10.7243/2050-2389-2-3