Table 2 : Sequence of oligonucleotide primers used for the amplification of PPP2R3C cDNA and derivatives to
clone into pVP16 and construction of chimera. The sequence of human GR cDNA primers used for cloning the
N-terminal AF- 1 serine mutants into pGEX vectors and construction of PPP2R3C-GRDBD and GRDBD-PPP2R3C
chimera are also shown.


Primer Sequence

PPP2R3C pVP16 &
Fusion Forward
5'-GGGGGGAGATCTCGAGGATATCACCATGGACTGGAAAGAAGTTCTTCGTC-3'
PPP2R3C pVP16 &
Fusion Reverse
5'-GGTCTAGATCAAGATCTCTCGAGTCATGTATCATCAAGGTCTGCAGAGTTTTCACTGTC-3'
PPP2R3C103-453
pVP16 Reverse
5’-TCGAGATCTATGGGATCCCCAGCAAAAACCATAAGTTCTGTAATTCTTCATT-3’
PPP2R3C 253-453
pVP16 Reverse
5’-TCGAGATCTATCCAATAAATCACAAGGAAGCAGCATGC-3’
PPP2R3C COOH
Fusion Reverse
5’-GGGGATATCTCTAGACTCGAGACATGTATCATCAAGGTCTGCAGAGTTTTCACTGTC-3’
hGR 5’ Primer 5’-GGCTCGAGGGATCCTCTAGAGAATTCACCATGGACTCCAAAGAATCATTAACTCCTGGTAG-3’
hGR 3’ Primer 5’-GGCTCGAGGATCCTCTAGAGAATTCTCACTTTTGATGAAACAGAAGTTTTTTGATATTTCC -3’
hGR DBD NH2
Fusion Forward
5'-GGATATCCGAATTCCTCGAGACCATGGCTTCAGGATGTCATTATGGAGTCTTAACT -3'
hGR DBD NH2
Fusion Reverse
5'-GGGGTCTAGATCTCACTCGAGACAGGTTTCTTGTGAGACTCCTGTATGGGCCTGCTG -3'
hGR DBD COOH
Fusion Forward
5'-GGGGAGATCTCGAGATGGCTTCAGGATGTCATTATGGAGTCTTAACT -3’
hGR DBD COOH
Fusion Reverse
5’-CTCGAGCTCGGGAGATCTTCAGGTTTCTTGTGAGACTCCTGTATGGGCCTGCTG -3’

Govindan et al.Molecular Biology and Genetic Engineering  2013 1:2DOI : 10.7243/2053-5767-1-2