Table 1 : Primers used in the qPCR reactions.


Gene
(amplicon size)
  Primers Annealing
temperature

EF1-α
(328 bp)
S
A
5’ CCCGGACACAGAGACTTCAT
5’AGCATGTTGTCACCATTCCA
62.1°C

Collagen type II
(223 bp)
S
A
5’ AGCAGGAATTTGGTGTGGAC
5’ TCTGCCCAGTTCAGGTCTCT
62.1°C

Collagen type X
(244 bp)
S
A
5’ TGCCAACCAGGGTGTAACAG
5’ ACATTACTGGGGTGCCGTTC
62.1°C

ALP
(260 bp)
S
A
5’ CCACGTCTTCACATTTGGTG
5’ AGACTGCGCCTGGTAGTT
54.2°C

Aggrecan
(202 bp)
S
A
5’ GACGCCGAGAGCAGGTGT
5’ AAGAAGTTGTCGGGCTGGTT
62.1°C

Mef2c
(155 bp)
S
A
5’ CCCAACTTTGAGTGCCAGT
5’ ATGTGAGGTCTCCACCCATC
55.3°C

Sox9
(304 bp)
S
A
5’ GAACGCACATCAAGACGGAG
5’ CTGGTGGTCTGTGTAGTCGT
56.2°C

Runx2
(115 bp)
S
A
5’ CAGACCAGCAGCACTCCATA
5’ GAGCGTCAACACCATTC
56.8°C

Stewart et al.Stem Cell Biology and Research  2016 3:1DOI : 10.7243/2054-717X-3-1